Everything below concerns drug affinity complex. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2025-09-07. Numbers and descriptions here follow the published literature rather than marketing material.
Lyophilized material is generally stable for extended periods when held at minus twenty degrees Celsius or below and protected from moisture and light. In solution the peptide is more labile; bond hydrolysis, aggregation and oxidation of susceptible residues all proceed faster at ambient temperature. Repeated freeze and thaw cycles should be avoided because they promote clumping and loss of soluble material. The conjugated variant adds a further consideration, since the maleimide group can hydrolyze in aqueous buffer and lose its ability to react with albumin.
Laboratory handling centers on minimizing exposure to water, heat and oxygen before use. Working solutions are typically prepared in sterile water or a mild buffer, and any residual particulate matter is removed by filtration. When the powder dissolves slowly, a small proportion of acetonitrile or dilute acetic acid is sometimes added as a co-solvent. Containers are kept sealed and desiccated between uses. Records of lot number, reconstitution date and storage conditions support later comparison of results across experiments.
The peptide backbone includes a D-alanine at position two, which resists cleavage by dipeptidyl peptidase IV, and several other substitutions that reduce degradation. Its molecular weight is roughly 3.4 kDa without the linker and about 3.6 kDa with it. The molecule is water soluble and is normally supplied as a lyophilized powder. Precise sequence and mass values depend on which variant is described, so technical documents usually state the exact form being referenced.
CJC-1295 is a synthetic peptide designed as a long-acting analogue of growth hormone-releasing hormone (GHRH). Its structure derives from the first 29 amino acids of native GHRH, a fragment often called GRF(1-29). Four substitutions were introduced to slow enzymatic breakdown and extend activity relative to the natural sequence. The compound was developed by ConjuChem as part of a broader effort to improve the pharmacokinetic profile of peptide hormones. It is studied in laboratory and clinical research settings rather than appearing as a naturally occurring substance.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off white powder | Typical lyophilized form |
| Water solubility | Soluble | May need a small organic co-solvent |
| Purity assessment | Chromatographic peak area | Most certificates report a percentage figure |
| Storage temperature | Minus 20 C or lower | Dry, dark, sealed container |
| Identity check | Electrospray mass spectrometry | Compared against theoretical mass |
Two forms circulate in research settings and are frequently confused. One carries the drug affinity complex and is often written as CJC-1295 with DAC; the other lacks that group and is usually called modified GRF(1-29). The two share the same core sequence but differ sharply in how long they persist in blood. Products labelled only as CJC-1295 normally refer to the version carrying the complex. Documentation that omits the distinction leaves the intended molecule ambiguous.
CJC-1295 is a synthetic peptide built as a long-acting analogue of growth hormone-releasing hormone. Its backbone matches the first twenty-nine residues of the natural human hormone, with four amino acid substitutions added to slow enzymatic breakdown. A reactive maleimide group, commonly termed the drug affinity complex, allows the peptide to attach to circulating albumin after administration. That albumin attachment keeps the molecule in the bloodstream for an extended period instead of being cleared within minutes.
Identity and purity are assessed mainly by reversed-phase high-performance liquid chromatography combined with mass spectrometry. The chromatographic separation resolves the target peptide from truncation products and from species carrying oxidised residues, while mass measurement confirms the expected molecular mass. Because the two common variants differ by roughly 280 daltons, a mass determination distinguishes them unambiguously. Purity is often quoted as a percentage of total peak area, although that figure depends on the detection wavelength and the integration method applied.
Reported half-lives differ widely between the two variants and between species. Values for the albumin-binding form are usually expressed in days, while the unconjugated form is measured in minutes to a few hours. Sampling schedules, assay sensitivity, and route of administration all influence the numbers, which limits direct comparison across studies. Whether sustained receptor occupancy produces different downstream effects from pulsatile stimulation remains an open question in the published work. Claims about relative potency should therefore be read alongside the specific study design that produced them.
Lyophilised powder is the usual supplied form. The material is hygroscopic, so vials are typically equilibrated to room temperature before opening in order to prevent condensation on the contents. Long-term storage is generally described at minus twenty degrees Celsius or colder, protected from light and moisture. Repeated freeze-thaw cycles are avoided because they promote aggregation and loss of soluble material. A reconstituted solution is considerably less stable than the dry powder and is normally kept refrigerated for short periods only.
CJC-1295 is the name used for a synthetic peptide modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. The compound was described by a Canadian drug discovery company in the mid-2000s as a long-acting research tool. Two closely related molecules share the name in practice: one carries a drug affinity complex, or DAC, group, and one does not. The distinction matters because the two behave differently in circulation.
The peptide backbone corresponds to GRF(1-29), the first 29 residues of native growth hormone-releasing hormone, which retains most of the receptor-activating activity of the full-length molecule. Four substitutions distinguish the analog from the natural sequence: D-alanine at position 2, glutamine at position 8, alanine at position 15, and leucine at position 27. These changes slow cleavage by dipeptidyl peptidase IV, the enzyme that degrades native hormone in plasma within minutes. The outcome is improved enzymatic stability combined with a still brief residence time when no additional modification is present.
(2026) review different models of evolution of European hominins during the Middle Pleistocene (including evolutionary models including all European population in the lineage ancestral to Neanderthals and the models proposing coexistence of multiple contemporaneous lineages in Europe) and the analytical frameworks supporting these models. García-Martínez et al. (2026) report the discovery of a parietal bone from a new paleoanthropological site Ruidera (Spain), providing evidence of variability of cranial morphology of Middle Pleistocene hominins. Yue et al. (2026) report evidence of production of diverse stone tools at the Xigou site (Henan, China) between 160,000 and 72,000 years ago, including evidence of well-organised core reduction strategies, production of diverse small flake-based tools, and hafted implements. The earliest evidence of use of sophisticated, systematic centripetal flaking systems in eastern Asia known to date is reported from the late Middle Pleistocene Lingjing site (Henan, China) by Zhao et al. (2026). Siemssen et al. (2026) report evidence of antibacterial properties of birch tar produced with methods used in Europe during the Middle Paleolithic. Guil-Guerrero (2026) argues that consumption of fly larvae by Neanderthals postulated by Beasley, Lesnik & Speth (2025) does not by itself explain nitrogen isotope enrichment observed in Neanderthal collagen, interpreted as more likely to be primarily caused by targeted hunting and consumption of megafauna by Neanderthals.
== Herbalism == A. mongholicus is used in traditional Chinese medicine (TCM). A. mongholicus is a component in Lectranal, a food supplement used in treatment of seasonal allergic rhinitis, though there is limited evidence of its effectiveness.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
=== Cinema and cultural workers === In July 2024, the Karnataka Legislative Assembly passed the Karnataka Cine and Cultural Activists (Welfare) Bill, providing for a welfare framework for workers in the cinema and cultural sector. The legislation included a proposed 2 percent cess on movie tickets and OTT subscriptions and provided for a welfare board.
The American Medical Association (AMA) declared war on Christian Scientists; in 1895 its journal called Christian Science and similar ideas "molochs to infants, and pestilential perils to communities in spreading contagious diseases." Juries were nevertheless reluctant to convict when defendants believed they were helping the patient. There was also opposition to the AMA's effort to strengthen medical licensing laws. Historian Shawn Peters writes that, in the courts and public debate, Christian Scientists and Jehovah's Witnesses linked their healing claims to early Christianity to gain support from other Christians. Vaccination was another battleground. A Christian Scientist in Wisconsin won a case in 1897 that allowed his son to attend public school despite not being vaccinated against smallpox. Others were arrested in 1899 for avoiding vaccination during a smallpox epidemic in Georgia. In 1900 Eddy advised adherents to obey the law, "and then appeal to the gospel to save ...[themselves] from any bad results." In October 1902, after seven-year-old Esther Quimby, the daughter of Christian Scientists, died of diphtheria in White Plains, New York (she had received no medical care and had not been quarantined), the authorities pursued manslaughter charges. The controversy prompted Eddy to declare that "until public thought becomes better acquainted with Christian Science, the Christian Scientists shall decline to doctor infectious or contagious diseases", and from that time the church required Christian Scientists to report contagious diseases to health boards.
Sources: en.wikipedia.org
== Symptoms == Desmosis is implicated in disturbed gut motility. Normal peristalsis depends upon the interaction between muscles, nerve cells and tendinous connective tissue. A malfunction of any of these leads to intestinal motility disorders. Patients with desmosis demonstrate chronic constipation.
== History == Carnitine was discovered in 1905 from muscle tissue, and it's chemical structure and properties were described in 1927. Carnitine's role as a vital metabolic compound was first hypothesized in 1952, when it was found to be essential to growth in mealworms. Mealworms with low carnitine "died fat", because they could not metabolize their stored fat when starved. Various studies in the 1950s showed that carnitine was acetylated by acyl-CoA and stimulated beta oxidation, which led researchers to the conclusion that carnitine transports fatty acids for metabolism.
Initially, not all cigarette smokers inhaled the smoke produced by cigarettes due to its high alkalinity levels. Starting in the 1930s, the tobacco industry began to conduct advertising campaigns encouraging the inhaling of cigarette smoke. However, Helmuth von Moltke noticed in the 1830s that Ottomans (and he himself) inhaled the Turkish tobacco and Latakia from their pipes (both are initially sun-cured, acidic leaf varieties).
=== Serum albumin purification === Affinity purification of albumin and macroglobulin contamination is helpful in removing excess albumin and α2-macroglobulin contamination, when performing mass spectrometry. In affinity purification of serum albumin, the stationary used for collecting or attracting serum proteins can be Cibacron Blue-Sepharose. Then the serum proteins can be eluted from the adsorbent with a buffer containing thiocyanate (SCN−).
=== Essential Bases === However, 23S rRNA positions (G2252, A2451, U2506, and U2585) have a significant function for tRNA binding in the P site of the large ribosomal subunit. These modification nucleotides in site P can inhibit peptidyl-tRNA from binding. U2555 modification can also intervene with transferring peptidyl-tRNA to puromycin. Furthermore, the chemical modification of half of these positions G2251, G2253, A2439, and U2584 can not prevent the tRNA binding. Peptidyl-tRNA of 50S subunits which binds to the P site preserve eight positions of 23S rRNA from chemical modification. On the other hand, mutation in 23S rRNA can also have impacts on cell growth. Mutations A1912G, A1919G and Ψ1917C have a powerful growth phenotype and they prevent translation while mutation A1916G has a simple growth phenotype and it leads to defect in the 50S subunits.
Sources: en.wikipedia.org
The mass difference from the linker is large enough for routine detection by mass spectrometry. The unconjugated form gives a single sharp signal at its expected weight. Material that has already reacted with albumin shows a much higher mass and a broadened chromatographic peak.
Yes. Degradation proceeds faster once the powder is dissolved, especially at room temperature or after multiple freeze and thaw cycles. Working solutions are often aliquoted to avoid repeated handling. Lyophilized powder held cold and dry retains its properties far longer.
Truncated sequences, oxidized residues and aggregated forms can all elute near the main peak. Reversed phase chromatography resolves many of these species, so the number of peaks is a useful indicator of synthesis quality. A single peak does not by itself prove correct sequence, which is why mass confirmation is paired with it.
No. It is a synthetic analogue modeled on the first 29 residues of human GHRH. The substitutions and any linker are laboratory modifications rather than features of the endogenous peptide.